TF-MAPS: fast high-resolution functional and allosteric mapping of DNA-binding proteins by @XianghuaLi2 Are Transcription Factors really 'undruggable'? www.biorxiv.org/content/10.1...

Many exciting opportunities for a PhD in Life Sciences in CRG, Barcelona. If you are interested in Genomics of Diabetes check out the offer for a fully funded fellowship in our lab - we will consider candidates with experimental or computational backgrounds. Please spread the word!

The Gaza Famine is the world’s famine. A preventable, predictable famine. Enough. Ceasefire. Open all crossings, north and south. Let us get food in, unimpeded and at massive scale.

A HNF1A-A1CF transcription-splicing axis is suppressed in β cells from #T2D individuals, while genetic variants reducing pancreatic islet A1CF are associated with increased glycemia and T2D susceptibility www.cell.com/cell-metabol...

An HNF1A-A1CF transcription splicing axis regulates insulin secretion, and breaks down in T2D. Amazing work led by Edgar Bernardo + Matias de Vas + major contributions from Diego Balboa, Silvia Bonas, Mirabai Cuenca, Fanny Mollandin, Merce Planas, Miquel Torrent, MA Maestro and many others

SUM-seq out @natmethods.nature.com !
 🚀 Ultra-high-throughput Multiplexed snATAC+RNA Used to: ⏳ link temporal macrophage GRNs to immune disease genetics 🩸 map T cell regulatory landscapes 🧬✂️ dissect TF function in hiPSC differentiation via CRISPRi/a screens doi.org/10.1038/s41592-025-02700-8 🧵

These are VERY rough estimates, but here's life expectancy after diagnosis of type-I diabetes over the past 150 years. It was Banting and Best's discovery of how to isolate insulin in 1921 — not some fucking cooking class — that gave people including my daughter a new lease on life.

Congratulations for this study in @Dev_journal, no small feat in Argentina's anti-Science climate

Want to improve your protein or genomic language model’s performance at zero-shot variant effect prediction? We propose a simple adjustment to likelihood-based predicton

📣 Join us @ ALMU! If you have expertise in SMLM, experience in building bespoke microscope systems -or you're excited to start building- are familiar with Python, and have a passion for optical microscopy, we’d love to hear from you! 👇 recruitment.crg.eu/content/jobs... Reposts appreciated-Thanks!

Tracing human clones and lineages with DNA methylation. Congratulations for this fascinating breakthrough!

Happy to share a work from the Helman lab on how beta cells sense and control their insulin secretion by Krell et al. in @CellReports. Beta cells intrinsically sense and limit their secretory activity via mTORC1-RhoA signaling: Cell Reports www.cell.com/cell-reports...

Molecular Correlates of Glycine Receptor Activity in Human β Cells https://www.sciencedirect.com/science/article/pii/S2212877825000638

Just heard from the VP research that my grant with @dgrand.bsky.social, "Promoting Accurate Information on Social Media" was terminated as well

Is the genome just a bag of genes? A new paper in Science now reports that for two thirds of an organisms' genes the position along the chromosome is actually very tightly constrained! Amazing work from my favorite night scientist Martin Lercher and his team! www.science.org/doi/10.1126/...

🚨🚨 New pre-print from the lab. led by the amazing @alejotorrescano.bsky.social ! Alejo & Co. elegantly decode the spatial logic of progenitor cell organization in the developing pancreas — from individual cells to structured cellular communities 🔬🔬🧫🧪 Check-it out ⤵️

@elpais.com Many established US scientists are taking a bold decision to move to Europe. EU is devoting funding to this but should be more ambitious elpais.com/ciencia/2025...

Accuracy of gene regulatory network inference is increased by combining multiome single-cell and atlas-scale bulk data go.nature.com/43YySqO rdcu.be/ebBio

We are looking for a keen bioinformatician for a fully funded PhD position! Drop me an email with your CV! www.findaphd.com/phds/project...

*last day* to register and submit your work in topics relevant to liver and islets in metabolic disease, including… - organoid models, regeneration, and synthetic biology - disease mechanisms and therapies - genome regulation - ….others

Join the exciting EMBO Workshop on Liver and Pancreas in Metabolic Disease, which brings together top-tier speakers in an outstanding seaside venue in April 🌊🌅. We’ve designed an interactive and engaging program—register now before it’s too late! ⏳👉 meetings.embo.org/event/25-liv...

Great work by @sviatoslavsidorov.bsky.social !

Still time to apply! Applications from US welcome – four years can feel longer or shorter depending on where you are 😉

Application deadline is get closer - make sure you do not miss this exciting EMBO workshop on liver and pancreatic biology and disease 😉 meetings.embo.org/event/25-liv...

If the past two meetings are any indication, this promises to be another great genome regulation workshop

Two great articles in Mol Cell about enhancer cooperativity & long-range enhancer activation by @chribue.bsky.social & Wysocka labs: www.sciencedirect.com/science/arti... www.sciencedirect.com/science/arti... Dimitra and I had the pleasure to write a Preview: www.sciencedirect.com/science/arti...

Join us in Belfast for our #epigenetics meeting and hear from fantastic speakers. Submit an abstract until 26 Jan and register until 23 Feb! Don't miss this chance to share your research & network with experts in the field. genetics.org.uk/events/epige...

If you’re interested in doing Postdoc work in Vancouver this is a great opportunity, check out our website and get in touch soon (www.betacell.ca)!

Introducing Human Domainome v1, the largest and most comprehensive library of human protein variants to date, which maps the effects of +500K mutations across 522 domains. The study by @benlehner.bsky.social and Toni Beltran is out now in @nature.com. Illustration by @queralttolosa.bsky.social.

Well isn't this cool??? www.medrxiv.org/content/10.1... Variants in RNU4-2 and RNU6 paralogues could account for up to 1.2% of undiagnosed retinitis pigmentosa cases! Really neat example of pleiotropy: different RNU4-2 variants underlie neurodevelopmental disorder (ReNU syndrome) and RP. 🤓🧬🖥️🩺❤️

Superb work by Wouter @Zouters & @OlgaPushkarev developing ChromatinHD, two scale-adaptive #machinelearning models & interpretation tools that use #scRNAseq + #scATACseq data to better understand how chromatin accessibility relates to gene expression doi.org/10.1038/s414... Happy 2025 everyone 🎆 !

🚨🚨🚨 If you're a bioinformatician who loves: 🧬 #SingleCell #LongReadSequencing & #AlternativeSplicing 🚀 Collaborating and travelling Apply to work with us at the spectacular BIMSB (@mdc-berlin.bsky.social) in Berlin + @upf.edu[email protected] in Barcelona. Qs: www.transdevolab.com Please RT! 🙏

📣 Hiring, please forward widely!! Two postdoc openings to work on genomics of diabetes 1. Computational regulatory genomics/statistical genetics. 2. Experimental cell-based modeling DM if interested @crg.eu shorturl.at/O3wMi shorturl.at/ieyZy

Join us in a beautiful location for this multidisciplinary experience. Top speakers linking topics such as organoid modeling, synthetic biology, gene regulation or genetics with disease mechanisms & new therapies for T1D, T2D, and MASLD meetings.embo.org/event/25-liver-pancreas

My top highlight for 2025 - EMBO workshop in Saint Feliu - three exciting days of science crossing boundaries of liver & pancreas research! Co-organised by @CebolaLab @1jorgeferrer @VallierLab @LickertHeiko & Emma Anderson #livertwitter #islets #masld #diabetes meetings.embo.org/event/25-liv...

Fancy 4 more years of beta cells? We are hiring a genomics post-doctoral researcher to join our team! Closing: 1st Jan, interviews: 13 Jan.. More info & application: www.birmingham.ac.uk/jobs Search JOB ID: 104642

First lab photo in bluesky, hiking from Vilanova to Sitges (missing Vahid).

Who would have thought that an actual sequence of a #microexon (GCAAGGACATATGGGCGAAGGAGA from CPEB4) would be in the headline of an article in @elpais.com! Congrats to the Mendez, @xsalvatella1.bsky.social and @jjlucaslab.bsky.social labs for this amazing work! english.elpais.com/science-tech...

We have many fully-funded PhD positions open at our research labs here in Barcelona. If you'd like to find out more, we're hosting an online workshop on the 13th of December 2025 (3PM CET) to learn how to find the right lab and experts tips on how to prepare an outstanding application. Register now!

Fascinating & unexpected from the Rodriguez lab on cell competition acting as a nutrient sensor Winner cells increase L-Proline uptake in losers, repressing their survival pathway (ISR) to kill them Explains old observations that starvation prevents competition www.biorxiv.org/content/10.1...

A new review entitled “Senescence as a therapeutic target in cancer and age-related diseases” from the Senescence group has been published in @natureportfolio.bsky.social 🥳 🧵: 1/12 www.nature.com/articles/s41...

Thrilled to share one of our biggest discoveries: “Inceptor binds to and directs insulin towards lysosomal degradation in beta cells”. doi.org/10.1038/s422... A tremendous collaborative effort led by JohannaSiehler, Sara Bilekova and other members of the Lickert lab @heikolickert.bsky.social

Hello! We are the CRG in Barcelona. We are quite used to blue skies around here.

Our recent study in Cell Metabolism provides compelling evidence that chromatin accessibility and transcription factor network remodeling in aging reflect the predictable degrading effects of a mechanism initially driving organismal maturation. Link: doi.org/10.1016/j.cmet.2024.06.006 Thread 🧵👇1/9

We are really looking forward to you joining in a few months. Exciting times!

Job opportunity for a clinician scientist @ims-mrl.bsky.social www.jobs.cam.ac.uk/job/49273/

This place feels like a breath of fresh air. I look forward to connecting with exciting science and anything else worth discussing