CGTACTGAGGAGGACAGCTACCTCACTAGCTACACTGAC In other words, Happy #DNADay! 🧬 https://earthsciweb.org/js/bio/dna-writer/

In Season 3, Episode 4 of the Lab Coats & Life™ Podcast, Editor-in-Chief of the Journal of Trial and Error, Dr. Sarahanne Field, challenges one of the most entrenched incentives in research: the pressure to publish only positive results. Listen wherever you get your podcasts!

It's hard to believe that #AAI2026 is already over! 🥺 We're delighted to have seen so many of you at our workshops, poster sessions, and booths. Revisit the highlights from #IMMUNOLOGY2026 and prepare for #AAI2027: https://bit.ly/4tlTBjE @aai.org#AAI2026

✈️ Heading to #AACR2026 next? Meet us tomorrow at booth #4829 as we support your cancer research in immuno-oncology, tumor biology, and cell therapy. @theaacr.bsky.social

Today is the final day at the #IMMUNOLOGY2026 exhibit hall! 📢 Swing by booth #511 for a final look at our instruments and discuss how we can support your #immunology research.

Streamline your #immunology research with tools that standardize cell preparation, isolation, sorting, culture, and engineering. If you're at #AAI2026, you can come see them in action at booth #511 or explore more here: bit.ly/4tlTBjE @aai.org (1/6) 🧵

🚨 Our second #AAI2026 workshop starts soon! Join Drs. Amanda Vanden Hoek and Amanda Durkin to discover how gentle Highway1™ cell sorting enhances end-to-end T cell workflows. @aai.org #IMMUNOLOGY2026

🎤 It’s podcast time! Catch @immunologypodcast.com's live podcast on emerging immunotherapies for solid tumors at #AAI2026 today at 11 am EST!

🕺Wind down and join us for our annual #immunology networking social at Trillium in Fort Point tomorrow at 7 pm! 🎟️ Swing by booth #511 to grab your ticket. ⁣Remaining #AAI2026 events and presentations: https://bit.ly/4tlTBjE

Be sure to check out our second and final #AAI2026 workshop tomorrow featuring the Highway1™ Cell Sorter! 📅 April 17th at 12:45 pm EST 📍 Exhibitor Workshop Room #1 @aai.org#AAI2026#IMMUNOLOGY2026

Mic check, 1, 2, 3... 🎙️ Join the @immunologypodcast.com tomorrow morning at 11:00 am in Room 157AB for a live recording with Drs. Charles Sentman and Giulia Escobar on emerging immunotherapies for solid tumors. @aai.org #AAI2026

🥧 WHOOPIE! Need a quick pick-me-up at #AAI2026? ⁣ Visit booth #511 for a pie! Request a free EasySep™ sample, test it, then share your feedback to enter for prizes up to $3,000, and qualify for 50% off your first EasySep™ https://bit.ly/4mcRmNu @aai.org#AAI2026

📌 Today’s #AAI2026 poster lineup! ⁣ 🕥 11:30 am | Poster #541 Dr. Grace Poon on automated tissue processing 🕥 2:30 pm | Poster #544 Dr. Ulrike Webb on microfluidic transfection @aai.org#AAI2026#IMMUNOLOGY2026

🚨 Happening today at #AAI2026! 🕥 12:45 pm EST 📍 Exhibitor Workshop Room #1 ⁣ Join us to hear Drs. Amanda Durkin, Grace Poon, and Ahmed Kabil share first-hand insights on how STEMprep™ automated tissue dissociation leads to reliable downstream analysis. @aai.org #IMMUNOLOGY2026

New to Boston? 🔍 Tomorrow, stop by booth #511 to pick up our insider's guide to Boston for a curated list of our favorite spots in the city! @aai.org #IMMUNOLOGY2026

Tomorrow, STEMprep™ is back for another exciting #AAI2026 workshop showcasing two new tissue-specific workflows 👀 📅 April 16th at 12:45 pm EST 📍 Exhibitor Workshop Room #1 @aai.org#AAI2026#IMMUNOLOGY2026

⏰ Set your alarms for #AAI2026 poster sessions #1 and #2 happening tomorrow at 11:30 am and 2:30 pm. Details on our topics and presenters below: @aai.org #IMMUNOLOGY2026 (1/3) 🧵

We’ve landed in Boston for #AAI2026! 🦞 Follow along for live conference updates on upcoming presentations and our featured products: https://bit.ly/4tlTBjE Starting tomorrow, visit booth #511 to play Reel Easy, win prizes, demo lab instruments, and connect with fellow scientists. @aai.org#AAI2026

Is the "relocation rule" real? 🧳 If you’re weighing a postdoc move, considering a faculty position, or thinking strategically about long-term independence, the latest episode of Lab Coats & Life™ Podcast offers a grounded and practical perspective. #GradLife

For decades, impact in science has been reduced to a number. But the founder of @altmetric.com, Dr. Euan Adie (@mrstew.bsky.social), explains that impact is far more subjective than we like to admit. Listen to the latest episode of the Lab Coats & Life™ Podcast, out now! 🎧 #PhDLife

Last year’s winner, Ian Shum, made it to the ISSCR Annual Meeting and now it’s your turn! 🫵 Enter now for a chance to win $1000 USD toward your registration fee and travel expenses to join us in Montréal for #ISSCR2026: https://bit.ly/4b4O3mh @isscr.org

New research provides the first detailed explanation of how parasite-fighting immune cells are selectively increased following infection. 🦠 https://bit.ly/4sYRAde #ImmunoSky @imm.ox.ac.uk @nature.com#ImmunoSky

Scientists from @mdc-berlin.bsky.social show that fat tissue releases signals that ultimately damage the intestinal barrier in Crohn’s disease. They also show that acquired genetic mutations in immune cells may fuel the disease. 🥼 #ImmunoSky https://bit.ly/4uDxeHV

Clear up common science myths. 🔎 This pocket guide is your handy reference sheet for when science steps outside the lab. 📖 Download your copy: https://bit.ly/3MFPkYX

😷 Prior exposure to one strain of influenza virus may weaken children's ability to mount an effective antibody response against subsequent exposure to a different flu strain, according to a new study in @nature.com. https://bit.ly/4s7eKxQ

A new season of the Lab Coats & Life™ Podcast has officially launched! 🎉 If you're thinking about making the leap from academia to industry, this conversation offers practical insight into what biotech employers are really looking for. #GradLife

Meet Sergiu Pasca, a neuroscientist whose work explores the biological basis of brain disorders such as autism and schizophrenia. Discover a favorite “aha” moment and the place he seeks out when he’s not in the lab. youtu.be/6QOptRJUH8k

What actually shapes a career in science? In Season 3 of the Lab Coats & Life™ Podcast, launching March 11, we zoom out from the bench to examine the systems surrounding researchers. 🔍 Listen wherever you get your podcasts, starting next week! Or catch up on our previous two seasons now. 🎧

There's often so much to do at a scientific event, but so little time. ⏳ We've gathered a few tips to help you make the most out of your next conference experience!

New research shows that DNA's 3D organization is constantly in flux. 🧬 Scientists found that the genome unfolds and refolds at different rates in different regions, influencing gene regulation and expression. @jesserdixon.bsky.social @tessapopay.bsky.social @salkinstitute.bsky.social

Check out a free course from the ISSCR and STEMCELL Technologies on how to apply the ISSCR Standards for Human Stem Cell Use in Research. Gain practical guidance you can apply to your current research to strengthen rigor, responsibility, and best practices. Sign up now 👉https://bit.ly/43Slc1G

🎙️ We've got a special episode out for you now! We chat with Drs. Fiona Doetsch and Nozomu Yachie about what to expect at the upcoming #ISSCR2026 meeting. 🎧 Check it out: https://bit.ly/3O6oN7s

We are proud to share that Takanori Takebe, MD, PhD, has been named to the 2026 #TIME100Health List of the World’s Most Influential Leaders in Health — becoming the first scientist from Cincinnati Children's to receive this honor. Learn more: https://ow.ly/qj8S50YcR5G

Turn your next conference talk into a performance that truly engages your audience! Learn public-speaking tips on timing, tone, and stepping away from the lectern to add a little showbiz to your #SciComm. 🎤 @nature.com#SciComm

A newly discovered immune pathway could lead to gentler treatments for multiple childhood brain cancers, according to new research from our Gilbertson Group published today in @natgenet.nature.com. Listen to first author Elizabeth Cooper discuss their findings. www.cruk.cam.ac.uk/news/new-imm...

🌡️ HOTT isn't just about temperature. Human Organoid Tumor Transplantation (HOTT) is one of the models Dr. Bhaduri's lab (@bhadurilab.bsky.social) developed to understand how interactions with #glioblastoma tissue and immune cells contribute to therapy failure. #Neuroskyence @dgsomucla.bsky.social

CD44 is the central traffic controller for immune system function. 🚦 A new @nature.com article finds that when viruses like cytomegalovirus hijack this system, it can impede efficient priming of naive #TCells and the initiation of antiviral CD8 T cell responses. Learn more: https://bit.ly/3NX2BfL

Try these three strategies from @nature.com if you're experiencing any writing apprehension on large or long-term projects. ✍️ 1. Set concrete goals 2. Develop structure and accountability 3. Write as you go

⚠️ Research interrupted by 2025 funding cuts? Applications are now open for the second round of the AAI RESTORE Grants Program. For Early-career researchers & PIs (R, K, F series, DP2/DP5, and more). The deadline is February 5, 2026. Learn more and apply: https://ow.ly/Z1yc50XWe83.

Congratulations to all the researchers involved in this discovery! 🧡

Phishheads 🤝 Cell biologists

Organoids models and CAR T cell therapy was used to research diffuse midline glioma (DMG) in the brainstem. 🧠 Researchers from @themaximacenter.bsky.social tested GD2-specific CAR T cells on DMG #organoids and found reduced effectiveness when microglia were present: https://bit.ly/4jBD2fY

Organoid Day is returning on February 12 in Singapore! 🎉 Join us for thought-provoking talks, interactive panel discussions, and networking opportunities: bit.ly/4qgZgX7

When you work in science, you're always looking at the data. Here's what shows up most often on stemcell.com! 🗨️ We type these words a lot. 🤪

Settle a debate. How do you pronounce mesenchymal? 👄

2026 will be the year you remember to celebrate your wins, not just troubleshoot experimental failures! 🌟

Take a look back at this year in science with @natbiotech.nature.com's top 10 news stories! 📰

Shaking things up in the lab. 😉❄️

Kidney assembloids from Pedro Medina in the Li lab made the list! 😍 We're in awe of all the images captured in 2025. Check out @nature.com's picks!

Stay prepared for conversations about science by taking our “Talking Science in the Wild” pocket guide with you wherever you go: bit.ly/4q91AyS