Exciting opportunity to join our team! Job: Genomics Technology Infrastructure Team Leader Please follow the instructions in the ad to apply (www.ensembl.info/2026/02/17/...). Closing date: 25/03/2026

Ensembl release 116 & Ensembl Genomes release 63 are coming in April 2026! Read more in our declaration of intentions blog: www.ensembl.info/2026/02/12/... From summer 2026, ensembl.org redirects to beta.ensembl.org. Previous versions remain in Ensembl Archives.

If you haven't shared your views on future genomics training & events yet, do it soon for a chance to win. 👀 Once completed, you'll be entered into a prize draw for a chance to win 1 of 3 registration passes (incl. accommodation) to a Connecting Science conference of your choice. 🎉 Link below ⤵️

We are at the Festival of Genomics in London! Join #Ensembl at the “Genome Dome” at 16:00 today to learn about latest new genomes and annotations available via beta.ensembl.org#Ensembl #FOG2026

Get to know the people behind Ensembl and meet Disha Lodha from the Ensembl Plants & Metazoa team in our latest #Teamsembl blog post at www.ensembl.info/2026/01/27/...

Exciting opportunity at Ensembl! We’re hiring a Bioinformatics developer to contribute to the development of the Ensembl Variant Effect Predictor (VEP). More info: www.ensembl.info/2026/01/22/... #Jobs #bioinformatics

Recruitment for the EMBL International PhD Programme is officially open! 🔊 At EMBL, we train young scientists to become skilled and creative future leaders in academia, industry and other sectors. Start your career in the life sciences with us! 🔎 Read more here: tinyurl.com/4jdt2ra5

Exciting opportunity at Ensembl! We’re hiring a Bioinformatician to help drive large-scale genomics and generate gene annotation for GENCODE or PARADIGM. More info: www.ensembl.info/2026/01/05/...

Service notice - we are working on server issues affecting the Ensembl mirror sites. Workaround - ensembl.org?redirect=no or an archive may2025.archive.ensembl.org/. You can try the new Ensembl site at beta.ensembl.org and let us know about the features you would like to see!

How can animal genomics communities coordinate data resources? Garth Ilsley presents with highlights from the FAANG and Ensembl Regulation data portals #PAG33

Uniprot @uniprot is developing new strategies and workflows for reference proteomes of agricultural species - Pedro Raposo presents at #PAG33

Elspeth Bruford presents on gene naming by the HUGO gene nomenclature committee, over 44000 genes named to date! “Nomenclature should not be offensive or pejorative”! @hgnc.bsky.social #PAG33

New long transcriptomic data are introducing complexities and opportunities into manual genome annotation! Jane Loveland @janeloveland.bsky.social shares new insights @gencodegenes.bsky.social #PAG33

José Pérez-Silva @jgperezsilva.bsky.social presents on gene annotation methods used by Ensembl at #PAG33

If you're in sunny San Diego for #PAG33, join us at our workshop, “Integrated Genome Resources at EMBL-EBI”, to learn more about our exciting new features and data resources for genomics and pangenomics! It's on Sunday 11 January from 8:00– 12:00, we hope to see you there!

New #GeneAnnotation has been added to #Ensembl Beta, including annotation for Dasypus novemcinctus and Buteo buteo! You can explore all available species here: beta.ensembl.org/species-sel... Image credits: commons.wikimedia.org/wiki/F... commons.wikimedia.org/wiki/F...

Hello, happy New Year! Three roles are currently open at Ensembl: Genomic Data Analyst Closing date: 10 Jan 2026 Genomic Data Analyst Project Lead Closing date: 10 Jan 2026 Senior Platform Developer Closing date: 24 Jan 2026 More info on current vacancies here (www.ensembl.info/category/06-...)

The HAVANA team at EMBL-EBI has multiple open positions to support the GENCODE and PARADIGM projects. We're recruiting gene annotators (bit.ly/4qG28g5), an annotation project lead (bit.ly/4qv05v6), and bioinformaticians (bit.ly/4qevYIY). Please apply via the links. We’d love to hear from you!

Riddle number two of the day: this photo was taken at the very last stop of our final Ensembl workshop of the year… can you guess where?

From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA" May your celebrations be as perfectly in‑frame as your favourite gene.

Ensembl Job alert! Bioinformatics Developer in Ensembl Compara Apply here: www.ensembl.info/2025/12/10/... Closing date: 12 January 2026

#OnThisDay 10 years ago, we launched the Open Targets Platform! 🎂 🧬🖥️

In Nov, @aleenamolbio.bsky.social from Ensembl Outreach visited Uni Valle Colombia to introduce 100 students from 3 public schools in Valle del Cauca to EMBL-EBI research & open-access bioinformatics training. Inspiring the next generation of scientists! 🌱🔬 #STEM #Bioinformatics #Outreach

Attention developers and researchers working with Ensembl programmatically! Upcoming Ensembl API and data access changes are live on our blog. Read more about the new platform, new services, and migration timelines here: www.ensembl.info/2025/12/02/...

Our Ensembl 2026 paper is out! Learn about 1,900+ new genomes, expanded pangenome support, new regulation interfaces, and what’s coming in our 2026 releases. doi.org/10.1093/nar/gkaf1239

New datasets available on beta.ensembl.org! Highlights include oats from the PanOat project, human assemblies from HPRC Release 2 and the pocket water lily, submitted by Fujian Agriculture and Forestry University Image credit - commons.wikimedia.org/wiki/F...

New Webinar: This Wednesday, join speakers Jorge Barista da Rocha, PhD, and Jane Loveland, PhD, as they explore the @ensembl.org genome browser and provide practical skills beyond the traditional reference genome. Register here: bit.ly/432kP4b #ASHG #HumanGenetics @gencodegenes.bsky.social

Antimicrobial resistance (AMR) is a growing health threat, making infections harder to treat and complicating routine medical care. EMBL-EBI’s new AMR portal brings together laboratory resistance data and bacterial genomes in one open platform. #WAAW2025 #ActOnAMR www.ebi.ac.uk/about/news/t... 🧬💻

Ensembl job alert! We are looking for a bioinformatics developer to join our Genebuild team: zurl.co/QpnKj Closing date: 11 Dec 2025

Join us tomorrow to explore Ensembl resources for pangenomes! Leanne Haggerty is presenting on Ensembl annotation for human, model organism, livestock & crop plant pangenomes. Free registration: zurl.co/3sSUJ  Full series:zurl.co/XrVdc #Pangenomes #Ensembl

🚨 NEWS! The GWAS Catalog Diagram is back up! 🚨 Smoother, faster loading for filtered views! 🗺️ Explore now 👉 www.ebi.ac.uk/gwas/diagram Tell us what you think! Are there any features you would like? Help us to make it useful for the #gwas community

As new human assemblies become available on beta.ensembl.org - which human reference genome will you choose? This article explores the question with insights from Ensembl’s own Fergal Martin - www.nature.com/articles/s41... #HumanGenomics #Pangenomes #ReferenceGenomes

Last day to add your input for #phytopathogen genome resources! Complete the survey before it closes: qualtricsxmpy46tq866.qualtrics.com/jfe/form/SV_...

📣Advance your skills in #pathogen genomics — no coding required — with the #Fungal Pathogen Genomics (Virtual) course #FungiDB @ensembl.org #mycocsm @yeastgenome.bsky.social #CGD 🗓️ 1–5 June 2026 Deadline: 16 March 2026 Apply here: coursesandconferences.wellcomeconnectingscience.org/event/fungal...

Ensembl Beta 14 is now live! We've added many more genomes, including Uroteuthis edulis, the Swordtip squid from the Aquatic Symbiosis Project. Find out if your favourite species is available with Ensembl Beta's Species Selector: zurl.co/BRLSE #Ensembl #NewRelease

FungiDB/VEuPathDB + Ensembl are teaming up to enhance fungal & oomycete genome resources — and we need your input! Complete the survey by Nov 1st, 2025: 
zurl.co/gKjC1 Your feedback will help guide decisions on genome curation, annotation & data integration.

Happy #AdaLovelaceDay from the @training.ebi.embl.org team!

Notice for users of Ensembl Rapid Release - this site has been archived and is now accessible at rapid-archive.ensembl.org. Any saved URLs will now redirect to the latest data on our new site- beta.ensembl.org Learn more on our blog: www.ensembl.info/2025/10/13/...

Cool update in Ensembl VEP (release 115): You can now annotate structural variants with @gnomad-project.bsky.social allele frequencies AND ClinVar clinical significance Perfect for filtering & interpreting SVs! More info on our blog (zurl.co/3lZjy) #genomics #bioinformatics

So, our definitive paper on the human reference gene set is out this week in Database (Oxford). We merged and compared @ensembl.org / @gencodegenes.bsky.social , RefSeq and UniProtKB coding genes and investigated the agreements and discrepancies. Details of what we found in the thread ...

Thank you very much Manovikas Kendra Kolkata for hosting our Ensembl Genome Browser and Train the Trainer workshops! I enjoyed learning about the neurodiversity research done here and it was great to see how it is readily applied to improving patient's lives!

Ensembl VEP makes variant annotation easy with access to key reference data for filtering and interpretation. Now includes MAVE results, offering further insights across nearly all possible variants in targeted regulatory or coding regions. More on our blog (zurl.co/Aj9HH) #bioinformatics #genomics

Ensembl is in Kolkata! 🇮🇳 we connected with researchers at #incob2025 in a workshop about our new Ensembl site - beta.ensembl.org! Thank you to all who attended for your great questions and to the organisers for this great event! - www.apbionet.org jcbose.ac.in/home

Ensembl Beta 13 is live! Check it out to see if your favourite species made the list-mine did! The Mountain Clouded Yellow was just added (beta.ensembl.org/species/fbf7...) #Genomics #OpenAccessData

🧬Our team member Sameh ElBadry was invited to deliver a seminar at the Wellcome Genome Campus, sharing how our Responsible Handover Framework of #AI has been integrated into Ensembl @ebi.embl.org @ensembl.org

Heads up! The Ensembl Rapid Release site (zurl.co/2iF0U) will be archived very soon. All links to it will redirect to our new site: zurl.co/PMirU The original data will remain accessible at zurl.co/9IQJv. Questions? Reach us at helpdesk [at] ensembl.org

Latest @deciphergenomics.bsky.social release is now out! Showcasing lots of new data on gene pages and the protein browser.

Fantastic few days of bioinformatics at [BC]²! 🧬 #bc2basel Thanks to everyone who joined our workshop on using Ensembl’s Variant Effect Predictor with alternative assemblies like T2T-CHM13v2.0. Excited for more great talks & posters today @sib.swiss

Meet @spider-m4n.bsky.social (Jorge Batista da Rocha) in our #TEAMsembl series, where he reflects on his first year at #Ensembl, training on the new browser, AI in learning, and… two dogs who can sniff out cheese 🧀 🐾 Read more at www.ensembl.info/2025/09/08/g...

We teamed up with @diplomics.bsky.social‬ to deliver Ensembl South African Workshop Series 🇿🇦 We were at Pretoria, Limpopo, Durban and Cape Town! Always inspiring to see how researchers are applying Ensembl in powerful ways #genomics #Bioinformatics #OpenAccess