Why does AI leave us both supercharged and exhausted? AI moves fast, but our brains have limits—and that's where burnout hits. I've learned the hard way that syncing my workflow to my brain's pace matters most. Ever hit this wall? Drop your thoughts or tips!

AI can code, but it can't architect your app. Human judgment keeps code maintainable. I turned 8,500 lines of AI-coded chaos into a plugin system—here’s what I learned. Ever cleaned up AI code? Repost or share your story! buff.ly/R1AIDyY #softwarearchitecture #aicoding

How do you keep mentoring and leading when budgets are tight? You don’t need big budgets—your skills and network are enough. Here are 5 budget-free ways I’ve helped others grow at work. What’s your go-to strategy? Comment or share! buff.ly/lAKet1K #.mentorship #.careergrowth

What’s the hidden bottleneck in your workflow? Air gaps—manual steps we ignore—add up fast. I share how spotting and closing these gaps saved me time and energy. Have you found air gaps in your work? Comment or repost if this rings true! buff.ly/lhmOcqL #automation #workflow

Are agent skills just for bots, or do they shape how we work too? Workflow skills reveal our habits, not just automate tasks. My daily sign-off skill bakes in my workflow—context matters! What do your automations say about you? buff.ly/flUlA9W #.agentskills #.workflow

PyMC in your browser? It works—just not with NUTS! WASM lets PyMC run client-side, but NUTS is still missing. Spent my weekend getting PyTensor running in WASM. Learned a lot, but NUTS is still out for now. Would you use PyMC in-browser? Repost or comment!

Drowning in work chaos? Plain text + AI agents keep me organized—no vendor lock-in. My Obsidian + Python workflow isn’t perfect, but it’s saved me hours and stress. How do you manage info overload? Comment or repost! buff.ly/BvEYHq8 #.pkm #.aiworkflow

Are coding agents making you better, or just faster? Speed means nothing if you lose control of your analysis. I found that slowing down and adding structure led to 5-10x speedups—without chaos. Does this match your experience? Repost or comment! buff.ly/mbVjECO #datascience #ai

Agentic coding is transforming data science. AI is a collaborator, not just a tool. I distilled 10 lessons from real ML projects—like agent journals and prescriptive prompts. These tips saved me days and sparked new ideas. Which tip would you try? bit.ly/409K82l #datascience #aiagents

📣 @ericmjl.bsky.social is teaching an "Agentic Data Science" workshop to raise funds for #SciPy2026 🗓️ March 27 & April 3, 2-4 PM EST 🎟️ $1,000 minimum donation ($200 for students) 👉️ Sign up at agent-assisted-data-science.vercel.app 👉️ Pay to NumFOCUS (tax-deductible) at givebutter.com/RBJuGI.

Model 'feel' can make or break your coding flow. Harness and feedback loops often matter more than model scores. Switching models and adding fast tests changed my workflow for the better. Agree? Repost or share your experience! buff.ly/Nv2cC1k #ai #devlife

Teaching an "Agentic Data Science" workshop to raise funds for SciPy 2026. Compress weeks of work into a day using coding agents. March 27 & April 3, 2-4 PM EST Google Meet 40 spots, $1,000 min donation paid directly to NumFOCUS (tax-deductible) Sign up: buff.ly/P1T2mh3 1/n

Treat your coding agent like a teammate, not a chatbot. I think the trick is knowing when to update AGENTS.md vs create a skill. I share my simple model for evolving agent workflows and building real leverage. What’s your approach? Comment or share! buff.ly/FluyXjj #.aiagents #.devworkflow

Tired of repeating the same coding steps? Skills—markdown playbooks—make agents smarter and your life easier. I share how skills saved me time and made team know-how reusable. Would you try skills? Comment or repost! buff.ly/rTPYdMf #.ai #.automation

Tired of repeating yourself to coding agents? Agents should actually learn from our feedback. AGENTS .md and simple playbooks helped my agents improve week by week—less babysitting, more progress. Tried this? Let me know or repost! buff.ly/5qi4pic #.ai #.automation

ICE murdered Renée Good in broad daylight. Less than 3 weeks later, they killed Alex Pretti, shooting him 10 times. Every day, we watch as people are ripped from their cars, their homes, their lives. We can't allow ourselves to look away from this cruelty. Abolish ICE.

Bioinformatics fixed my browser bug. DNA sequence alignment beat string normalization for messy text highlighting. Smith-Waterman, a DNA algorithm, solved my canvas-chat issue. Cross-domain ideas really work! Ever tried a wild fix? Comment or share! buff.ly/wnq3Ewz #.webdev #.algorithms

First contact with GLM-4.7 and... yeah, it feels a lot like Opus 4.5. One-shotting coding problems. I gotta probe where its limits are.

Ever wish LLM chats could branch like your thoughts? Linear chat holds us back—so I built Canvas Chat for nonlinear exploration. Open-source, infinite canvas for branching and merging ideas with Claude, GPT, and more. Repost or comment if this sparks ideas! buff.ly/KaFK4fR #.ai #.opensource

AI themed my tmux bar—no plugins needed. AI let me focus on design, not syntax. Claude + OpenCode turned ideas into a terminal I love. You just need vision! How has AI changed your workflow? Repost or comment! buff.ly/aCXmjK1 #tmux #aipairprogramming

I don't code anymore—I build. AI lets me ship projects by describing what I want, not how to do it. In 10 days, I shipped 6 projects with OpenCode + Claude Opus 4.5. The gap between idea and product is tiny now. Would you try this? Repost or comment! buff.ly/blroW24 #ai #buildfast

atggaacgccgctattgccatcgcattagcaccatggcgagcgcgaacgatcatgcgccgccgtataacgaatggtatgaagcgcgc! (if you know, you know what to do!)

🎄Merry Christmas to all! 104 blog posts. 2 years. Here’s what changed for me. Writing weekly turned AI into a true collaborator. Lessons on coding agents, Bayesian stats, and biotech leadership—shared honestly. What did 2025 teach you? Comment or repost! buff.ly/Kkebg57 #blogging #datascience

Why do your best work if your company won’t notice? I think it’s about investing in yourself, not just your job. I share how building reputation and resilience pays off down the road. Ever had effort pay off later? Comment or share! buff.ly/SyXPuJc #careeradvice

Stop letting coding agents run wild—take control for better results. AI is a collaborator, not just a tool. My top tips: plan with AI, write docs/tests first, and use AGENTS.md as your agent’s guidebook. Got your own agent tips? Share below! buff.ly/kudW7pd #aiagents #productivity

3. A massive 24 year long Danish study demonstrated that, no, aluminium adjuvants in vaccines are not dangerous. They save around 4 million lives a year (11k lives A DAY.) www.altmetric.com/de... Explained in glorious detail by @sailorrooscout.bsky.social here: bsky.app/profile/sai... 4/8

'Folk statistics' is costing science billions. AI can help, but only if we build it right. I built an AI stats agent for experiment design—sharing what worked, what failed, and why prompts matter. Faced these issues? Repost or comment! buff.ly/UGinNw9 #ai #statistics

Coding agents can access any repo—no workspace limits! Just give Copilot or Claude the file path and skip the hassle. I stopped copying files and juggling configs. It’s way simpler than I thought. Would you try this? Comment or share! buff.ly/EP7thlP #codingagents #productivity

307 lines of agent code—now just 4. Graph-based LLMs are clearer and more powerful. PocketFlow let me rebuild my AgentBot with a tiny, declarative graph. Cleaner code, instant visualization, and a new mindset for agents. Would you try this? Repost or comment! buff.ly/vQo50AX #llm #aiagents

Coding agents can wreck your repo in seconds. Auto-approve only read-only commands—never risky ones. I share my setup for safe agent autonomy and lessons learned. How do you keep agents in check? Comment or repost! buff.ly/PetnnVz #ai #automation

AI agents + Marimo notebooks = Python on autopilot. Letting AI write and check my Marimo code is a total workflow upgrade. The --watch flag and marimo check catch errors fast and keep me moving. Would you try this? Repost or comment! buff.ly/6LDN1RV #python #datascience

By definition, AI agents are always going to be out of date. AI agents need live, searchable knowledge. I share how LlamaBot's MCP server keeps docs fresh and accessible for any LLM agent. How can this help you? Repost or comment! buff.ly/5td8FNC #ai #documentation

Skills cut token costs—MCP servers win for sharing. Which is better for LLMs? Skills = fast, local tweaks. MCP = team standard. I compared Anthropic's skills repo to MCP servers—real trade-offs, not just hype. Which would you use? Repost or comment! buff.ly/zhV1XfO #llm #aiworkflows

Coding agents flop without real workflows—prompts aren't enough. Discipline and feedback loops make agents useful. TDD-first, external memory, and fast iteration changed my game. What’s your best agent tip? Comment or share! buff.ly/yH5Hjkv #aicoding #devworkflow

What if your coding agent could remember your preferences? AGENTS.md lets you train your LLM agent like an employee. This one file made my workflow smoother—no more repeating myself! Would you try this? Repost or comment! buff.ly/LinjaUs #.aiagents #.devtips

Ultralearning is a superpower to mastering tough skills quickly. Courses aren't enough—self-driven ultralearning is the real unlock. I break down how ultralearning helps you grow fast, whether it's bio, software, or any field. What will you ultralearn next? buff.ly/2l4z68Z #ultralearning #growth

Still fighting Python environment headaches? I’ve moved to pixi—automation and new tools are the future. My Data Science Bootstrap Notes now use pixi, uv, and AI. This is my recommended workflow for 2025. Would you make the switch? Comment or repost! buff.ly/MoXJJhL #.datascience #.python

AI isn’t just for code—here’s how I use it to boost my career. LLMs help me prep for negotiations, updates, and tough convos. 10 ways I save time and stand out at work, with prompts you can steal. Which would you try? Comment or repost! buff.ly/OkXup6p #aihacks #careerdevelopment

Ever wonder why your stats brilliance doesn’t land with lab scientists? Clarity beats complexity every time. Here’s how I learned to lead with decisions, not methods. What’s your best tip for bridging the gap? buff.ly/8Zuli8E #biotech #datatips

🔥 You can rewrite Python functions live! It’s wild, risky, and opens up new AI tricks. I tried dynamic patching—super powerful, but security is a real concern. Here’s what I learned. Would you try this, or is it too risky? buff.ly/RqGBgE1 #python #ai

Are data scientists obsolete now that LLMs can code? I see LLMs as tools that reshape, not replace, our work. Experimenting with LLMs has made our scientific mindset more valuable than ever. What’s your take? Repost or comment! buff.ly/o9PnXhR #llms #datascience

I've been eval pilled by @hamel.bsky.social . Everyone is all let's build some MCP servers and ship a minimal AISRE as quickly as possible. And I'm writing a design doc about how to build evals with @runme.dev so we can iterate rapidly on the AI

RFdiffusion2 is now live! github.com/RosettaCommo... You can now design proteins, and in particular enzymes from just partially defined amino acid side chains, and without defining their sequence position or order!

Stop guessing priors—R2D2 puts you in control. I think R2D2 is a breakthrough for Bayes modeling. It automates shrinkage and variance allocation for clearer, less overfit models. Would you try this? Repost or comment! buff.ly/kcbOuG6 #bayesianstats #statmodeling

AI can't replace the grind—you have to earn your automation. My 2-day feature rewrite only worked because of months of prep. I share how struggle made AI a true thinking partner, not a shortcut. Have you tried this approach? Repost or comment! buff.ly/TG4xOqr #.ai #.softwaredev

🧵Americans should really hear how the CDC in other regions talks about us.

They spread the lie for years that public health professionals are enemies. Now, a policeman is dead, and the lives of CDC personnel and their kids were at risk. There'll be "deep concern" and thoughts & prayers. But architects of that lie will celebrate privately because this has been the goal.

CDC Buildings Hit by Gunfire : MAGA’s war on truth works exactly as designed...turn Americans against science, poison them with propaganda, and watch them die from preventable causes… all while calling it “freedom.” This is the bill for their lies. www.medpagetoday.com/publichealth...

What if all your lab and ML data lived in one place? Index chaos is optional—xarray keeps everything aligned. I show how this cuts errors and makes analysis smoother. Would this help your workflow? Repost or comment! buff.ly/6QXFDY4 #xarray #datamanagement

What keeps me coming back to #scipy after 10 years? The community’s curiosity and generosity are unmatched. From teaching to spontaneous podcast chats, every year brings new inspiration and growth. Got a favorite conference story? Comment or repost! buff.ly/gRAMkoC #scipy #python