Ever wish LLM chats could branch like your thoughts? Linear chat holds us back—so I built Canvas Chat for nonlinear exploration. Open-source, infinite canvas for branching and merging ideas with Claude, GPT, and more. Repost or comment if this sparks ideas! buff.ly/KaFK4fR #.ai #.opensource

AI themed my tmux bar—no plugins needed. AI let me focus on design, not syntax. Claude + OpenCode turned ideas into a terminal I love. You just need vision! How has AI changed your workflow? Repost or comment! buff.ly/aCXmjK1 #tmux #aipairprogramming

I don't code anymore—I build. AI lets me ship projects by describing what I want, not how to do it. In 10 days, I shipped 6 projects with OpenCode + Claude Opus 4.5. The gap between idea and product is tiny now. Would you try this? Repost or comment! buff.ly/blroW24 #ai #buildfast

atggaacgccgctattgccatcgcattagcaccatggcgagcgcgaacgatcatgcgccgccgtataacgaatggtatgaagcgcgc! (if you know, you know what to do!)

🎄Merry Christmas to all! 104 blog posts. 2 years. Here’s what changed for me. Writing weekly turned AI into a true collaborator. Lessons on coding agents, Bayesian stats, and biotech leadership—shared honestly. What did 2025 teach you? Comment or repost! buff.ly/Kkebg57 #blogging #datascience

Why do your best work if your company won’t notice? I think it’s about investing in yourself, not just your job. I share how building reputation and resilience pays off down the road. Ever had effort pay off later? Comment or share! buff.ly/SyXPuJc #careeradvice

Stop letting coding agents run wild—take control for better results. AI is a collaborator, not just a tool. My top tips: plan with AI, write docs/tests first, and use AGENTS.md as your agent’s guidebook. Got your own agent tips? Share below! buff.ly/kudW7pd #aiagents #productivity

3. A massive 24 year long Danish study demonstrated that, no, aluminium adjuvants in vaccines are not dangerous. They save around 4 million lives a year (11k lives A DAY.) www.altmetric.com/de... Explained in glorious detail by @sailorrooscout.bsky.social here: bsky.app/profile/sai... 4/8

'Folk statistics' is costing science billions. AI can help, but only if we build it right. I built an AI stats agent for experiment design—sharing what worked, what failed, and why prompts matter. Faced these issues? Repost or comment! buff.ly/UGinNw9 #ai #statistics

Coding agents can access any repo—no workspace limits! Just give Copilot or Claude the file path and skip the hassle. I stopped copying files and juggling configs. It’s way simpler than I thought. Would you try this? Comment or share! buff.ly/EP7thlP #codingagents #productivity

307 lines of agent code—now just 4. Graph-based LLMs are clearer and more powerful. PocketFlow let me rebuild my AgentBot with a tiny, declarative graph. Cleaner code, instant visualization, and a new mindset for agents. Would you try this? Repost or comment! buff.ly/vQo50AX #llm #aiagents

Coding agents can wreck your repo in seconds. Auto-approve only read-only commands—never risky ones. I share my setup for safe agent autonomy and lessons learned. How do you keep agents in check? Comment or repost! buff.ly/PetnnVz #ai #automation

AI agents + Marimo notebooks = Python on autopilot. Letting AI write and check my Marimo code is a total workflow upgrade. The --watch flag and marimo check catch errors fast and keep me moving. Would you try this? Repost or comment! buff.ly/6LDN1RV #python #datascience

By definition, AI agents are always going to be out of date. AI agents need live, searchable knowledge. I share how LlamaBot's MCP server keeps docs fresh and accessible for any LLM agent. How can this help you? Repost or comment! buff.ly/5td8FNC #ai #documentation

Skills cut token costs—MCP servers win for sharing. Which is better for LLMs? Skills = fast, local tweaks. MCP = team standard. I compared Anthropic's skills repo to MCP servers—real trade-offs, not just hype. Which would you use? Repost or comment! buff.ly/zhV1XfO #llm #aiworkflows

Coding agents flop without real workflows—prompts aren't enough. Discipline and feedback loops make agents useful. TDD-first, external memory, and fast iteration changed my game. What’s your best agent tip? Comment or share! buff.ly/yH5Hjkv #aicoding #devworkflow

What if your coding agent could remember your preferences? AGENTS.md lets you train your LLM agent like an employee. This one file made my workflow smoother—no more repeating myself! Would you try this? Repost or comment! buff.ly/LinjaUs #.aiagents #.devtips

Ultralearning is a superpower to mastering tough skills quickly. Courses aren't enough—self-driven ultralearning is the real unlock. I break down how ultralearning helps you grow fast, whether it's bio, software, or any field. What will you ultralearn next? buff.ly/2l4z68Z #ultralearning #growth

Still fighting Python environment headaches? I’ve moved to pixi—automation and new tools are the future. My Data Science Bootstrap Notes now use pixi, uv, and AI. This is my recommended workflow for 2025. Would you make the switch? Comment or repost! buff.ly/MoXJJhL #.datascience #.python

AI isn’t just for code—here’s how I use it to boost my career. LLMs help me prep for negotiations, updates, and tough convos. 10 ways I save time and stand out at work, with prompts you can steal. Which would you try? Comment or repost! buff.ly/OkXup6p #aihacks #careerdevelopment

Ever wonder why your stats brilliance doesn’t land with lab scientists? Clarity beats complexity every time. Here’s how I learned to lead with decisions, not methods. What’s your best tip for bridging the gap? buff.ly/8Zuli8E #biotech #datatips

🔥 You can rewrite Python functions live! It’s wild, risky, and opens up new AI tricks. I tried dynamic patching—super powerful, but security is a real concern. Here’s what I learned. Would you try this, or is it too risky? buff.ly/RqGBgE1 #python #ai

Are data scientists obsolete now that LLMs can code? I see LLMs as tools that reshape, not replace, our work. Experimenting with LLMs has made our scientific mindset more valuable than ever. What’s your take? Repost or comment! buff.ly/o9PnXhR #llms #datascience

I've been eval pilled by @hamel.bsky.social . Everyone is all let's build some MCP servers and ship a minimal AISRE as quickly as possible. And I'm writing a design doc about how to build evals with @runme.dev so we can iterate rapidly on the AI

RFdiffusion2 is now live! github.com/RosettaCommo... You can now design proteins, and in particular enzymes from just partially defined amino acid side chains, and without defining their sequence position or order!

Stop guessing priors—R2D2 puts you in control. I think R2D2 is a breakthrough for Bayes modeling. It automates shrinkage and variance allocation for clearer, less overfit models. Would you try this? Repost or comment! buff.ly/kcbOuG6 #bayesianstats #statmodeling

AI can't replace the grind—you have to earn your automation. My 2-day feature rewrite only worked because of months of prep. I share how struggle made AI a true thinking partner, not a shortcut. Have you tried this approach? Repost or comment! buff.ly/TG4xOqr #.ai #.softwaredev

🧵Americans should really hear how the CDC in other regions talks about us.

They spread the lie for years that public health professionals are enemies. Now, a policeman is dead, and the lives of CDC personnel and their kids were at risk. There'll be "deep concern" and thoughts & prayers. But architects of that lie will celebrate privately because this has been the goal.

CDC Buildings Hit by Gunfire : MAGA’s war on truth works exactly as designed...turn Americans against science, poison them with propaganda, and watch them die from preventable causes… all while calling it “freedom.” This is the bill for their lies. www.medpagetoday.com/publichealth...

What if all your lab and ML data lived in one place? Index chaos is optional—xarray keeps everything aligned. I show how this cuts errors and makes analysis smoother. Would this help your workflow? Repost or comment! buff.ly/6QXFDY4 #xarray #datamanagement

What keeps me coming back to #scipy after 10 years? The community’s curiosity and generosity are unmatched. From teaching to spontaneous podcast chats, every year brings new inspiration and growth. Got a favorite conference story? Comment or repost! buff.ly/gRAMkoC #scipy #python

Straight talk from Dr. Francis Collins on the devastating - and politically motivated - cuts to science and public health in the United States. Anybody who cares about their health or the future or science, technology, and innovation in this country should watch this. www.cnn.com/2025/07/25/T...

Can AI actually make us worse learners if we use it too soon? We should earn the privilege to use automation—basics first. A real story of AI in education gone wrong, and why process matters. Seen AI help or hurt learning? Share your thoughts! ericmjl.github.io/blog/2025/7/... #aiineducation

The real competition for your docs? It's not that strong. Even basic docs beat digging through Slack or bugging teammates. You don't need perfect docs—just make them the fastest way to get things done. Are your docs the easiest option? ericmjl.github.io/blog/2025/7/... #documentation #productivity

ICE vehicle getting towed at St John's hospital (Oxnard, CA) ✊🏽

UTAH… this is not a game…

Ever tried building with the weirdest tech stack and AI? I built a receipt scanner in just over an hour using FastAPI, HTMX, Notion, and Claude Code—all in the terminal. The results surprised me! Check it out, let me know what you think, and please share or retweet! buff.ly/TeqvJra #ai #devtools

I recently spoke at Data-Driven Pharma, where I built my own tool to automate slide drafting, and shared why building your own tools can be so empowering. #buildyourowntools #datascience Read my story, share your thoughts, and retweet if you relate! ericmjl.github.io/blog/2025/6/...

Vaccination schedules on the CDC website have already started changing under RFK Jr. So we published a guide to the evidence-based vaccine recommendations in place *before* all 17 members of the advisory panel were abruptly dismissed by the new admin. www.scientificamerican.com/article/see-... 🧪

Are chatbots the endgame for LLMs? I share why I think the future is contextual tools, not just chat. Lessons from building DeckBot and rethinking AI interfaces. Read, share, and let me know your thoughts! ericmjl.github.io/blog/2025/6/... #aiux #llm

running list of things trump promised during the 2024 campaign: - grocery prices would decrease - working families will get a tax cut - entitlements would be protected - balance the budget and pay down debt - he would end foreign wars

Are you using AI to learn, or just to get answers? I've found that #ai works best as a learning partner when we ask questions and think critically, not just consume. Read my post, share your thoughts, and retweet if you agree! ericmjl.github.io/blog/2025/6/... #ai #learning

Ever wondered why model pickers slow you down? Cursor's new automatic model routing removes those tiny choices so I can stay focused. Small change, big impact! Give it a read and let me know if you feel the difference too. Share or comment! ericmjl.github.io/blog/2025/5/... #aitools #ux

Tired of juggling updates across multiple repos? I used to struggle too—until I tried multi-repo workspaces in VSCode. Now my coding agents see everything at once! Check out my tips, share your thoughts, and retweet if helpful! ericmjl.github.io/blog/2025/5/... #vscode #llm

Why is SciPy 2025 in Tacoma a must-attend event? Excited for SciPy 2025! From the stunning Pacific Northwest to the amazing community of tool builders, there's so much to look forward to. 🌟 What are your thoughts? ericmjl.github.io/blog/2025/5/... #scipy2025 #python

Ever wondered how to deploy web apps *actually* #serverless-ly? Modal is a game-changer for efficient app deployment. Here are my experiments, from a PyPI server to a serverless workstation and more -- ericmjl.github.io/blog/2025/4/... #cloudcomputing

If you're at #PyConUS I would LOVE to talk to you about my various projects - I'll be stood next to my poster in Hall A tomorrow from 10am to 1pm - it's the one with the "teenage bedroom" aesthetic, I decided to fill all available space with photos of things I like simonwillison.net/2025/May/17/...

What are good practices for AI-assisted software development? In this blog post, I share insights from a live coding demo at BioIT World 2025. ericmjl.github.io/blog/2025/4/... #datascience #ai #standardization #bioitworld #softwaredevelopment