🦊🥷

Affirmations going into 2026: I am alive, and Margaret Thatcher is not I woke up this morning, and Thatcher didn't My mother is alive, and Mark and Carol Thatcher's isn't I am alive and well, and Thatcher is long since worm food

hey man can us westerners get some of that Nice Comfy Thing but in larger sizes please

wishing all Online Video Player Makers a very Make Muted The Default Sound Level

the fire station is busy today cant imagine why

the least Nobby dot

duuuuuuuuuuude i wish i was funny

big opinion: "click and drag to scroll" controls on desktop are fucking stupid give me buttons. i am on a computer, not a phone

"ughhhhh theres nothing giving me what i want to seee" have you tried looking for it or do you need a stupid dumdum poopyass bot to find it for you? do you need it to feed you? read you bedtime stories? tuck you into bed? fuck you

"oh yeah i know the kid from Deltarune! Frisk, right?" the helpful Noddy Holder from the UK rock band Slade:

Has anyone tried replacing the cowbells in phonk with airhorns and calling it honk

sideboob

i hate shitting on people but like, if your TOS says that you refuse to do any editing of the lines to accommodate a body shape of a character, what kind of artist are you?? bodies vary massively in both shape and dimensions and if you just refuse to do that, youre just lazy. please learn shapes

ffxiv dawntrail raid tierlist going by vibes overall (music, mechanics, difficulty, how much fun i have)

AAA video game character going to the toilet: "I'll take these stairs." "Ah, there it is, the bathroom." "Better open the door." "The door's open, nice." "Gonna pull my trousers down now." "Sitting down." "Okay, here we go." "I needed that." "Okay, time to fl

fun fact: if you don't include the method of payment in the commission info there is a guaranteed 0% chance i'll think about commissioning you

every day this becomes more true

troubleshooting a balatro mod for people who dont troubleshoot be like "i have tried nothing and im all out of ideas! your mod was installed among the many so im going to ask you to fix it NOW!!!!!!"

you know, i think i have to rank literally any type of wine on F in a tier list my innocent ass thought it would taste fruity and feel thick but nope!!!! it tastes like shit

SPONGEBOY ME BOB, I HAVE UNRAVELLED MY DNA SEQUENCE AND I AM IN MASSIVE PAIN CACCACATATGCTGTCTCTGGCACGTGGATGGTTTAGAGGAATCAGATTCAAGTCTGGTTAACCATCAAACAGGTCTTGAGTCTAAAATTGTCGTCTCCTGCGTACGAGATGGAAATACTAGGTAACTACAGGGACTCCGACGTTATGTACGTTGCTCCGTCAGAGGCGCCATTCAGGATCACGTTACCGCGAAAAAAAGGGACCAGGAGCTCTTCTCCCCTG

"is ffxiv b-" yes

you can save 100% on your shopping by simply walking out with it follow me for more money-savinf tips

i forgot about the gift strike image i made so i will repost it . i hope everyone gets their gift strike today

CIA Realizes It’s Been Using Black Highlighters All These Year theonion.com/cia-realizes...

vibe coding (ai)? no vibe coding (remote controlled buttplug) hell yeah

why the fuck is the Grinch this year's Christmas mascot

"People often name new species they discover after themselves. I guess this animal expert wants to remain anonymous."

this is such a good dialogue box that actually is in this game

if plugins cant remove shorts from my homepage at least ubo can- hey what the fuck man

"oh boy I can't wait to get the new iPhone" fuckers when "I've been using the same android phone from 2018 for the past five years because phones are expensive and it isn't broken yet" walks in please pretend there's an image here I don't have anything

I find it funny that people can go "tom morello I love your music but I dislike your politics" and you look at tom morello's politics and it's just "I hate inequality and Nazis and the government and I love people who are against them"

"plump and juicy" says the packet of chicken breast as I get home, cut into it and yep, it's full of water again

hitting play on a paused video when i come back to it so the little guys in my computer arent subjected to be frozen in stasis forever

rot13 7.4 msq end V svaq vg ernyyl shpxvat shaal gung unyznehg frr hf ybbx ng ure naq ernyvfr gung jr VZZRQVNGRYL pybpxrq ure nf n guerng qrfcvgr abg orvat eboorq ng nyy vf terng V ubcr fur tvirf hc naq gntf nybat

thinking about how we're gonna break the news to the remaining Ascians that their grand plan has been ruined for a while now emet selch fucking died and we killed him elidibus was absorbed into a god damn crystal and was used as a battery zodiark was put down like a rabid dog

"i have to use ai to generate placeholder assets or quick concept art for artists to work with" hey buddy theres this thing called paint and its free and comes with your computer i did this in 60 seconds with the mouse. you have no excuse

If FFXIV was one of those bad mobile game ads

load-bearing Lv 1

wise words from a healer main: every tankbuster is an opportunity for a free lb gain tick. go experiment.

ffxiv no context

the fact that twitter changed it's "share link" format to be /i/######## is that I now have to play russian roulette when I share things because I can't remember what they are is it a cute animal or the hottest porn you've ever seen? let's find out in a sfw server (':

if you see a car parked on the pavement on a main road, you as a pedestrian have every right to scuff that car up as you pass it, because "for safety, the damage was inevitable" is a valid excuse imo

I wake up I have breakfast I get dressed I leave for work the sun is already setting wonder why I feel like shit I guess I'm getting supplements when I go shopping next

Hey all new strat what do you think

fun fact that you cannot unsee now; the difference between a miqote and an umamusume is the ear angle

Merriam-Webster’s human editors have chosen ‘slop’ as the 2025 Word of the Year.