Just an incredible achievement to get a new vaccine to clinical trial in just 8 weeks. Obviously still lots to do, but this shows what pandemic preparedness is capable of. 🧪💉 www.ox.ac.uk/news/2026-07-13-worlds-first-phase-i-bundibugyo-ebolavirus-vaccine-trial-launched-by

Is there mould on the international space station 🚀🦠? I analyzed DNA from the ISS dinner table 🧬🖥️, my favorite find was lots of kimchi bacteria. Kimchi went to space, but the bacteria was killed first. 🧪 Why do you think kimchi bacteria doing so well in space? towardsdatascience.com/space-mould/

What's living on the international space station dinner table? I used metagenomics to investigate and found a tasty surprise! 🧪🧬🖥️This blog walks through the code, what microbes I found, and how kraken2 works towardsdatascience.com/space-mould/

Find this mouth in the garden recently. Can anybody help me to ID? Plants 🌱🇬🇧 #bugsky

My new favorite website map.blitzortung.org 🌩️⚡ not just for awesome live data vis but for the collaboration of weather nerds building lightning detectors and sharing the data

*looks sceptical in perl* 🐪🧬🖥️🧪

Delighted to share some good news 🧪 “This hugely encouraging news shows the life-saving impact of the HPV vaccine, and it’s incredibly exciting to be able to say to this whole generation: cervical cancer shouldn’t be a risk for you,” says Caroline Temmink www.newscientist.com/article/2530...

Hantaviruses use "cap snatching" to start reading instructions from their genome. They cut up host mRNA and use that as primers for their own transcription. You can see this in their transcripts because they start with unrelated fragments of host sequence 🧪🧬🦠

New flu study shows that when you feel worse, you're probably spreading more virus particles. 🧪In particular, coughing, runny nose, and feeling bleh were correlated with virus particles expelled into the air. #flu www.cell.com/cell/fulltext/S0092-8674(26)00232-1

In humans, sub unit vaccines are often designed around predicted t cell epitopes. What you would focus on in species without an adaptive immune response is such an interesting question! 🧬🖥️🧪

Using open source resources viralrecon and pathoplexus, it only took 3 days from declaring an outbreak to reporting the viral genomes as district from previous Bundinugyo outbreaks. 🖥️🧬 virological.org/t/initial-ge...

The Indian muntjac deer only has 6 or 7 chromosomes, less than any other mammal 🦌 because in the last 5 million years their chromosomes have fused together 26 times! 🧬 🖥️ #chromosome #deer

I recently learnt that muntjac deer are native to South East Asia. At the start of the 1900s a handful escaped from a private collection at Woburn Abbey. Despite this population bottleneck, there are now over 100,000 in the UK

India’s genomic map reveals ~130M variants—many previously unknown. Strong population structure + rare, population-specific variants expose limits of Eurocentric datasets. Precision medicine needs diversity, not assumptions. #Genomics #PrecisionMedicine #HumanDiversity tinyurl.com/3mverx3p

Very happy to say that the 🧬 🖥️ tool HLAfreq is now published doi.org/10.21105/joss.10122 Use it to combine HLA allele frequency datasets. I made it to help vaccine design but love seeing it put to other uses. Let me know if it's useful to you! 🧪 #hlafreq

The USDA pomological watercolors are a beautiful catalog of fruit in America. I made this figure to show which fruit are in that collection. The bigger the fruit the more times it features in the collection. It is full of apples 🍎🍏! Made with #figtreemap #sciart #apples

The USDA phonological watercolors are a collection of beautiful botanical illustrations I've been admiring. Exploring then was made much easier thanks to pomological.art/. Are there any similar collections of animal scientific illustrations you'd recommend? #sciart

Exploring cancer types with neo4j, a guide to identifying clusters in knowledge graphs 🧬🖥️🧪 @neo4j.com medium.com/data-science...

📢Introducing GENOTIPE, HIS Special Interest Group. 🧬GENOTIPE brings together the expertise needed to turn genomic innovation into practical and sustainable use within healthcare settings, aligned with NHS and public health priorities. 🔗More info: https://ow.ly/JMWY50YNm7k #Genomics #IPC #🧪

Computer scientists share their advice for ensuring that your scientific software does what it’s supposed to do go.nature.com/48wyHXp

Scientists have confirmed that group A strep can be identified in ancient remains. They found pathogen DNA in a prehispanic mummy from Bolivia — raising the question: Where did strep (and diseases like scarlet fever) originate? 🧪🏺

The number of spaces missions per animal species 🐕🚀. Inspired by [animals in space](www.nationalgeographic.com/magazine/gra...) made with [figtreemap](quantitative-omics-research.github.io/figtreemap/) #space

Gorgeous! Reminds me of ggpomological garrickadenbuie.com/project/ggpomological/#color-palette a beautiful colour palette and ggplot theme 🍎🍏

Of course, that's great because I love White-throated Sparrows so much. Did you know that their two color morphs aren't actually the male and female plumages (as some old field guides say)? Thanks to a genetic quirk, they've basically got 4 sexes! www.sciencehistory.org/stories/disa...

CATGAACTGCTGCAGTGGCAGCGCCTGGAT